BBa_K806004 1 BBa_K806004 cspD - stationary phase/starvation inducible regulatory protein 2012-09-23T11:00:00Z 2015-05-08T01:13:25Z We clone this gene in E.coli strain BL21 with primer cspD-F and cspD-R. cspD-F sequence：GCTCTAGAGCATGGAAAAGGGTACTGTTAAGTGGTT cspD-R sequence：GGACTAGTCCCTATGCGACTGCCGCTTCTACTT cspD genebank id：AM946981.2 We find a better way to slow down the cell cycle of E.coli,by stop the initiation of DNA replication. CsdD effect-ively inhibits both the initiation and the elongation steps of minichromosome replication in vitro.[1] we cloned and overexpressed it to slow down certain kind of cells in a mix quorum system, in order to maintain a more stable system and achieve better energy partition. [1]Yamanaka, K. Zheng, W. Crooke, E. Wang, Y.-H. Inouye, M. CspD, a novel DNA replication inhibitor induced during the stationary phase in Escherichia coli. MOLECULAR MICROBIOLOGY. 2001, VOL 39; PART 6, pages 1572-1584. false false _1063_ 0 11692 9 It's complicated false 1. Add restriction enzyme site on both end 2. clone the gene from genomic DNA extraction for better effect. false Chang Ye annotation2196023 1 CspD range2196023 1 1 225 BBa_K806004_sequence 1 ctatgcgactgccgcttctacttcgacgggcacaataacactggcgtgattgccttttggcccctggtggacatcaaactgaacggattgtccagcttttagcgttctgtaaccatccatctgaatggtggaataatgagcgaaaatatcttcgccgccgccttcagggcagatgaaaccaaaccctttggcattgttgaaccacttaacagtacccttttccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z