BBa_K807001 1 LexA DBD Yeast Codon Optimized LexA DNA Binding Domain 2012-09-27T11:00:00Z 2015-05-08T01:13:25Z Sequence was derived from the E.coli LexA repressor. Synthesized piece of DNA from IDT that was yeast codon optimized for optimal functioning. The first 252bp of the LexA repressor corresponding to the DNA binding domain were synthesized. false false _1064_ 0 9288 9 In stock false Had to take the LexA CDS and design primers to amplify the DNA binding domain only with no stop codon. false Ian Roney annotation2203856 1 LexA DBD range2203856 1 1 252 BBa_K807001_sequence 1 atgaaggctttgactgctagacaacaagaagttttcgacttgatcagagaccacatctctcaaactggtatgccaccaactagagctgaaatcgctcaaagattgggtttcagatctccaaacgctgctgaagaacacttgaaggctttggctagaaagggtgttatcgaaatcgtttctggtgcttctaggggtatcagattgttgcaagaagaagaagaaggtttgccattggttggtagagttgctgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z