BBa_K809004 1 COB termin Terminator of Yeast mitochondrial gene COB 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z It comes from Saccharomyces cerevisiae S288C mito-chromosome region This is the terminator region for COB gene. It is selected from Yeast mito-chromosome, and we want to test it in our experiment. false false _1066_ 0 12018 9 Not in stock false We modelled the RNA secondary structure of COB 3'UTR region, and found that the secondary structure of this region is very similar to bacterial terminator sequence. false Xiaopeng Xu annotation2194600 1 stem_loop range2194600 1 11 40 BBa_K809004_sequence 1 attatagttccggggcccggtcacggaagccggaaccccgcaaggagatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z