BBa_K809006 1 Q0255 term Terminator of Yeast mitochondrial gene Q0255 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z We modelled the RNA secondary structure of Q0255 3'UTR region, and found that the secondary structure of this region is very similar to bacterial terminator sequence. This is the terminator region for Q0255 gene. It is selected from Yeast mito-chromosome, and we want to test it in our experiment. false false _1066_ 0 12018 9 Not in stock false This is obtained from Saccharomyces cerevisiae S288C mito-chromosome region. http://www.yeastgenome.org/ false Xiaopeng Xu annotation2194556 1 stem_loop range2194556 1 16 37 BBa_K809006_sequence 1 atattaattaagtttcgggtcccggctacgggacccggaacccccgagaggagttattatattta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z