BBa_K809009 1 OLI1 RBS RBS sequence of yeast mitochondrial gene OLI1 2012-09-23T11:00:00Z 2015-05-08T01:13:26Z This is obtained from Saccharomyces cerevisiae S288C mito-chromosome region. http://www.yeastgenome.org/ This is the RBS region for OLI1 gene. It is selected from Yeast mito-chromosome, and we want to test it in our experiment. false false _1066_ 0 12018 9 Not in stock false The sequence between the last ATG codon and CDS on the 3'UTR DNA sequence is believed to contain RBS. With some modifications, we made those sequences BioBricks. false Xiaopeng Xu BBa_K809009_sequence 1 atgttaattatatataatatatttatatataattatatatatatatataaataataataaatatatatataatataaaaataagaatagattaaatatttaataaataaatatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z