BBa_K809201 1 SPzim17 signal peptide of ZIM17 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Zim17, a novel zinc finger protein essential for protein import into mitochondria. J Biol Chem. 2004 Nov 26 ;279(48):50243-9. Epub 2004 Sep 21 . http://www.uniprot.org/uniprot/P42844 this part is the sequence of transit signal peptide of ZIM17. It can help protein target to the mitochondrial matrix. false false _1066_ 0 12995 9 It's complicated false it is synthesized based on the complete sequence of signal peptide of ZIM17 false Luohao Xu BBa_K809201_sequence 1 atgattccgaggactagaacactactgcaaagtaaaataccaattaccaggtactttgccagatgttgggcgcctcgcgtacgctacaacgtgtgccgtactctacccgcagcagcgttgcataccaatatcatcgcacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z