BBa_K809202 1 SPfer signal peptide of FER 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Chloroplast transit peptides: structure, function and evolution, Barry D Bruce, Trends in Cell Biology - 1 October 2000 (Vol. 10, Issue 10, pp. 440-447) http://www.uniprot.org/blast/?about=P07839[1-32] This is the signal peptide of ferredoxi from chroloplast, which can help protein target to matrix of chroloplast false true _1066_ 0 12995 9 It's complicated false it is synthesized without any modification for the original sequence false Luohao Xu BBa_K809202_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z