BBa_K809203 1 SPtim21 signal peptide of TIM21 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829. This is the signal peptide of TIM21, which helps protein target to the inner membrane of mitochondrion false true _1066_ 0 12995 9 It's complicated false It is synthesized entirely from the original sequence false Luohao Xu BBa_K809203_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z