BBa_K809204 1 SPtom40 signal peptide of Tom40 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Eukaryote-wide sequence analysis of mitochondrial β-barrel outer membrane proteins This is the signal peptied of Tom40, which can direct the assembly of β-barrel protein into outer membrane of mitochondrion false false _1066_ 0 12995 9 It's complicated false No modification for the original sequence false Luohao Xu BBa_K809204_sequence 1 ttttgcggtgaaatcgatcatttcaagaacgataccaagattggttgcggtctacaatttgaaactgctggtaatcaagaattactaatgttacaacaaggtttagacgcagatggtaacccattgcaagctcttcctcaattgtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z