BBa_K809206 1 SPtom22 signal peptide of Tom22 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Plant Physiol. 2000 123: 811-816. doi:10.1104/pp.123.3.811 This is the signal peptide of Tom70, which can direct tail-anchored protein to mitochondrial outer membrane false false _1066_ 0 12995 9 Not in stock false It is synthesized according to the sequence found in database false Luohao Xu BBa_K809206_sequence 1 atttctaatttttttggttttactagctcttttgtgagaaatgctttcacaaaatccggaaaccttgcttggactttgaccaccactgctttgttactcggtgtgccactatccttatctatacttgccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z