BBa_K809207 1 BBa_K809207 signal peptide of Tom20 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z Rapaport, D. (2003). "Finding the right organelle." EMBO Rep 4(10): 948-952. This is the signal peptide of Tom20, which can direct N-terminally anchored protein to mitochondrial outer membrane false false _1066_ 0 12995 9 It's complicated false It is synthesized according to the sequence in database false Luohao Xu BBa_K809207_sequence 1 atgtcccagtcgaaccctatcttacgtggcctcgctattacaacagccatagctgctctatcagccaccggttatgctatctactttgactatcaaagaagaaatagcccgcaattcagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z