BBa_K809313 1 YFP_SPzim1 YFP + signal peptide of ZIM17 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809201 YFP is linked with signal peptide of ZIM17, thus can be directed into mitochondrial matrix. It is used to test and signal peptide. false false _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2245061 1 BBa_E1030 component2245059 1 BBa_K809201 annotation2245061 1 BBa_E1030 range2245061 1 150 179 annotation2245059 1 BBa_K809201 range2245059 1 1 141 BBa_K809201 1 SPzim17 signal peptide of ZIM17 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Zim17, a novel zinc finger protein essential for protein import into mitochondria. J Biol Chem. 2004 Nov 26 ;279(48):50243-9. Epub 2004 Sep 21 . http://www.uniprot.org/uniprot/P42844 this part is the sequence of transit signal peptide of ZIM17. It can help protein target to the mitochondrial matrix. false false _1066_ 0 12995 9 It's complicated false it is synthesized based on the complete sequence of signal peptide of ZIM17 false Luohao Xu BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809313_sequence 1 atgattccgaggactagaacactactgcaaagtaaaataccaattaccaggtactttgccagatgttgggcgcctcgcgtacgctacaacgtgtgccgtactctacccgcagcagcgttgcataccaatatcatcgcacattactagagtaatacactgatagtgctagtgtagatcac BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac BBa_K809201_sequence 1 atgattccgaggactagaacactactgcaaagtaaaataccaattaccaggtactttgccagatgttgggcgcctcgcgtacgctacaacgtgtgccgtactctacccgcagcagcgttgcataccaatatcatcgcacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z