BBa_K809202 1 SPfer signal peptide of FER 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Chloroplast transit peptides: structure, function and evolution, Barry D Bruce, Trends in Cell Biology - 1 October 2000 (Vol. 10, Issue 10, pp. 440-447) http://www.uniprot.org/blast/?about=P07839[1-32] This is the signal peptide of ferredoxi from chroloplast, which can help protein target to matrix of chroloplast false true _1066_ 0 12995 9 It's complicated false it is synthesized without any modification for the original sequence false Luohao Xu BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809314 1 YFP_SPfer YFP + signal peptide of FER 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809202 YFP is linked with signal peptide of ferredoxi, thus can be directed into matrix of chloroplast. false true _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2245035 1 BBa_E1030 component2245033 1 BBa_K809202 annotation2245033 1 BBa_K809202 range2245033 1 1 96 annotation2245035 1 BBa_E1030 range2245035 1 105 134 BBa_K809202_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcc BBa_K809314_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcctactagagtaatacactgatagtgctagtgtagatcac BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z