BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809203 1 SPtim21 signal peptide of TIM21 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Chacinska, A., M. Lind, et al. (2005). "Mitochondrial Presequence Translocase: Switching between TOM Tethering and Motor Recruitment Involves Tim21 and Tim17." Cell 120(6): 817-829. This is the signal peptide of TIM21, which helps protein target to the inner membrane of mitochondrion false true _1066_ 0 12995 9 It's complicated false It is synthesized entirely from the original sequence false Luohao Xu BBa_K809315 1 YFP_SPtim2 YFP + signal peptide of Tim21 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809203 YFP is linked with signal peptide of Tim21, thus can be directed to mitochondrial inner membrane. It is used to test and signal peptide. false true _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2245036 1 BBa_K809203 component2245038 1 BBa_E1030 annotation2245036 1 BBa_K809203 range2245036 1 1 96 annotation2245038 1 BBa_E1030 range2245038 1 105 134 BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac BBa_K809315_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcctactagagtaatacactgatagtgctagtgtagatcac BBa_K809203_sequence 1 atggccatggctatgcgctccaccttcgccgcccgcgttggcgctaagcccgctgtccgcggtgctcgccccgccagccgcatgagctgcatggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z