BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809316 1 YFP_SPtom4 YFP + signal peptide of Tom40 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809204 YFP is linked with signal peptide of Tom40, thus can be directed to mitochondrial outer membrane. It is used to test and signal peptide. false false _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2245064 1 BBa_E1030 component2245062 1 BBa_K809204 annotation2245062 1 BBa_K809204 range2245062 1 1 147 annotation2245064 1 BBa_E1030 range2245064 1 156 185 BBa_K809204 1 SPtom40 signal peptide of Tom40 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Eukaryote-wide sequence analysis of mitochondrial β-barrel outer membrane proteins This is the signal peptied of Tom40, which can direct the assembly of β-barrel protein into outer membrane of mitochondrion false false _1066_ 0 12995 9 It's complicated false No modification for the original sequence false Luohao Xu BBa_K809316_sequence 1 ttttgcggtgaaatcgatcatttcaagaacgataccaagattggttgcggtctacaatttgaaactgctggtaatcaagaattactaatgttacaacaaggtttagacgcagatggtaacccattgcaagctcttcctcaattgtgatactagagtaatacactgatagtgctagtgtagatcac BBa_K809204_sequence 1 ttttgcggtgaaatcgatcatttcaagaacgataccaagattggttgcggtctacaatttgaaactgctggtaatcaagaattactaatgttacaacaaggtttagacgcagatggtaacccattgcaagctcttcctcaattgtga BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z