BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809317 1 YFP_SPtom7 YFP + signal peptide of Tom70 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809205 YFP is linked with signal peptide of Tom70, thus can be directed to mitochondrial outer membrane. It is used to test and signal peptide. false false _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2245065 1 BBa_K809205 component2245067 1 BBa_E1030 annotation2245065 1 BBa_K809205 range2245065 1 1 90 annotation2245067 1 BBa_E1030 range2245067 1 99 128 BBa_K809205 1 SPtom70 signal peptide of Tom70 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Rapaport, D. (2003). "Finding the right organelle." EMBO Rep 4(10): 948-952. This is the signal peptide of Tom70, which can direct N-terminally anchored protein to mitochondrial outer membrane false false _1066_ 0 12995 9 It's complicated false It is synthesized according to the sequence found in datebase false Luohao Xu BBa_K809317_sequence 1 atgaagagcttcattacaaggaacaagacagccattttggcaaccgttgctgctacaggtactgccatcggtgcctactattattacaactactagagtaatacactgatagtgctagtgtagatcac BBa_K809205_sequence 1 atgaagagcttcattacaaggaacaagacagccattttggcaaccgttgctgctacaggtactgccatcggtgcctactattattacaac BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z