BBa_E1030 1 cohmYFP cohmYFP (July 2004) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z A.victoria and computation (c/o DNA 2.0 and others) cohmYFP: Codon Optimized, Homology Minimized Yellow Fluorescent Protein. Excitiation peak: ### nm Emission peak: ### nm false false _11_1_ 0 52 7 Not in stock false false Drew Endy annotation2214016 1 Help:Barcodes range2214016 1 6 30 BBa_K809318 1 YFP_SPtom2 YFP + signal peptide of Tom22 2012-09-24T11:00:00Z 2015-05-08T01:13:26Z http://partsregistry.org/wiki/index.php?title=Part:BBa_E1030 http://partsregistry.org/wiki/index.php?title=Part:BBa_K809206 FY is linked with signal peptide of Tom22, thus can be directed to mitochondrial outer membrane as a tail-anchored protein. It is used to test and signal peptide. false false _1066_ 0 12995 9 Not in stock false Both parts should be linked correctly without frame shift and nonsense mutation false Luohao Xu component2372842 1 BBa_E1030 component2372840 1 BBa_K809206 annotation2372840 1 BBa_K809206 range2372840 1 1 130 annotation2372842 1 BBa_E1030 range2372842 1 139 168 BBa_K809206 1 SPtom22 signal peptide of Tom22 2012-09-22T11:00:00Z 2015-05-08T01:13:26Z Plant Physiol. 2000 123: 811-816. doi:10.1104/pp.123.3.811 This is the signal peptide of Tom70, which can direct tail-anchored protein to mitochondrial outer membrane false false _1066_ 0 12995 9 Not in stock false It is synthesized according to the sequence found in database false Luohao Xu BBa_K809206_sequence 1 atttctaatttttttggttttactagctcttttgtgagaaatgctttcacaaaatccggaaaccttgcttggactttgaccaccactgctttgttactcggtgtgccactatccttatctatacttgccg BBa_E1030_sequence 1 taatacactgatagtgctagtgtagatcac BBa_K809318_sequence 1 atttctaatttttttggttttactagctcttttgtgagaaatgctttcacaaaatccggaaaccttgcttggactttgaccaccactgctttgttactcggtgtgccactatccttatctatacttgccgtactagagtaatacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z