BBa_K809403 1 ROP+P ROP+Promoter in mitochondria 2012-09-23T11:00:00Z 2015-05-08T01:13:27Z 1. Brekasis, D. and M. S. Paget (2003). "A novel sensor of NADH/NAD+ redox poise in Streptomyces coelicolor A3(2)." EMBO J 22(18): 4856-4865. 2. Deshpande, A. P. and S. S. Patel (2012). "Mechanism of transcription initiation by the yeast mitochondrial RNA polymerase." Biochim Biophys Acta. 3. http://regulondb.ccg.unam.mx/ This is regulatory sequence which can be repressed by binding of REX on ROP site. false false _1066_ 0 12018 9 Not in stock false With different place of ROP and promoter, the effect of REX binding on ROP might differs. false Xiaopeng Xu BBa_K809403_sequence 1 ttgcttgtgaatgtgaacgcgttcacaagcgtatataagtaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z