BBa_K810000 1 BBa_K810000 Lambda phage beta CDS with T5 promoter 2012-09-27T11:00:00Z 2015-05-08T01:13:27Z The promoter region was amplified from the plasmid pBAV1K-T5-gfp (Bryksin and Matsumura, 2010). The coding sequence was amplified from E. coli strain SIMD50 as described in Datta, et al., 2006. This coding sequence is originally from the bacteriophage lambda. This part features the coding sequence for the recombinase of the bacteriophage lambda, called beta. It has been fused with a promoter designed by Bryksin and Matsumura (2010) that has been shown to promote transcription in both Gram-positive and Gram-negative organisms. It is flanked by XbaI and SpeI and features a KpnI restriction enzyme site between the promoter and coding sequence. It was designed to go in plasmid pBAV1K (Bryksin and Matsumura) which replicates in both Gram-positive and Gram-negative bacteria. false false _1067_ 0 12597 9 It's complicated false The CDS for beta is downstream of the T5-lac promoter from plasmid pBAV1K-T5 described by Bryksin and Matsumura, 2010. The construct was designed to be cloned into pBAV1K to create a construct that could be used across species. false Spencer R Katz annotation2203769 1 T5 promoter range2203769 1 1 57 annotation2203767 1 bet CDS range2203767 1 83 868 annotation2203774 1 KpnI restriction enzyme site range2203774 1 77 82 annotation2203772 1 LacO range2203772 1 7 25 annotation2203771 1 -10 signal range2203771 1 24 31 annotation2203770 1 -35 signal range2203770 1 1 7 annotation2203773 1 LacO range2203773 1 39 57 annotation2203768 1 RBS range2203768 1 65 76 BBa_K810000_sequence 1 tttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaattactagagaaagaggagaaaggtaccatgagtactgcactcgcaacgctggctgggaagctggctgaacgtgtcggcatggattctgtcgacccacaggaactgatcaccactcttcgccagacggcatttaaaggtgatgccagcgatgcgcagttcatcgcattactgatcgttgccaaccagtacggccttaatccgtggacgaaagaaatttacgcctttcctgataagcagaatggcatcgttccggtggtgggcgttgatggctggtcccgcatcatcaatgaaaaccagcagtttgatggcatggactttgagcaggacaatgaatcctgtacatgccggatttaccgcaaggaccgtaatcatccgatctgcgttaccgaatggatggatgaatgccgccgcgaaccattcaaaactcgcgaaggcagagaaatcacggggccgtggcagtcgcatcccaaacggatgttacgtcataaagccatgattcagtgtgcccgtctggccttcggatttgctggtatctatgacaaggatgaagccgagcgcattgtcgaaaatactgcatacactgcagaacgtcagccggaacgcgacatcactccggttaacgatgaaaccatgcaggagattaacactctgctgatcgccctggataaaacatgggatgacgacttattgccgctctgttcccagatatttcgccgcgacattcgtgcatcgtcagaactgacacaggccgaagcagtaaaagctcttggattcctgaaacagaaagccgcagagcagaaggtggcagcatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z