BBa_K812052 1 BBa_K812052 pLac promoter R0010 with GoldenBrick extension 2012-09-19T11:00:00Z 2015-05-08T01:13:27Z This part has been created from R0010 by PCR amplification This part is the GoldenBricked version of R0010 pLac promoter. The sequence is the same but the biobrick sequence have been modified to enable GoldenBrick assembly, adding a BsaI site and the possibility of BbsI digestion of the scar once formed. To learn more about the GoldenBrick assembly our team have invented this year, go to: http://2012.igem.org/Team:Evry/GB false false _778_ 0 8998 9 It's complicated false The part R0010 has been amplified by PCR with the new GoldenBrick extension, and then cloned in pSB1C3 using EcoRI and PstI. false Cyrille Pauthenier BBa_K812052_sequence 1 gaattcggtctcacgctctagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacagaagacagagaccactagtactgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z