BBa_K817000 1 BBa_K817000 SP1-GLP1 2012-09-23T11:00:00Z 2015-05-08T01:13:28Z SP1-GLP1 Released HQ 2013 This is the GLP-1 coding part along with the signal peptide sequence. false false _1075_ 0 13572 9 In stock true SP1-GLP1 false Yen-Der Li annotation2201480 1 GLP-1 range2201480 1 65 162 annotation2201479 1 SP1 range2201479 1 1 64 BBa_K817000_sequence 1 atgaaacagagcaccattgcgctggcgctgctgccgctgctgtttaccccggtgaccaaagcgcatgcggaaggcacctttaccagcgatgtgagcagctatctggaaggccaggcggcgaaagaatttattgcgtggctggtgaaaggccgcggctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z