BBa_K817015 1 BBa_K817015 srnBC toxin-antitoxin cassette 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z F plasmid It is type I toxin-antitoxin which belongs to hok/sok homologues, it expresses stable toxin encoded RNA and short lived antitoxin RNA that can neutralize toxin RNA by RNA interaction. It acts as post segregation killing system, which kills bacteria when it loss the DNA(genomic islands, plasmids, mobile gene elements) that contains it. Therefore we use it to reduce plasmid loss rate and make applications without antibiotics selection pressure more feasible. false false _1075_ 0 13960 9 In stock false This part only functions when there is not the same srnBC present in the same cell(those F' E.coli like JM109 contain srnBC), or it will be neutralize and functionless . false Shan Chi Hsieh annotation2187455 1 srnB' range2187455 1 278 427 annotation2187454 1 srnB range2187454 1 221 427 annotation2187453 1 srnC range2187453 1 173 234 BBa_K817015_sequence 1 gaacaataatttacggtttcgcgctatagctggctcaagttaggttggaccctgaatctccagacaaccaatatctgatcgcgccagtggtggcagttattaagcaacagggaatgtggtattatcgcggcgggtgtctgagcctttctggttcaggcaagacgcaggtaccagaaatgcgaagaccccacttgttaatccattaactcgtgaggtctgcatgaagtaccttaacactactgattgtagcctcttccttgcagagaggtcaaagtttatgacgaaatatgcccttatcgggttgctcgccgtgtgcgctacggtgttgtgtttttcactgatattcagggaacggttatgtgagctgaatattcacaggggaaatacagtggtgcaggtaactctggcctacgaagcacggaagtaagctgccgggcggggacggaagtccccgctttccggaagtgtgaggtatttcaggggcagacacccgacatgccagaaacagccggtcccgcccggggccggcacccaggttcaggcatttcctgcttttcagtcatttcattatcaaaatcacattaaacggtcgtaatcagac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z