BBa_K817018 1 BBa_K817018 gamma-delta resolvase cassette 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z E.coli F plasmid transposon tn1000(tn3 family) Released HQ 2013 These cassette is encodes an autoregulated resolvase(serine type recombinase)from E.coli F plasmid transposon tn1000(tn3 family). Its promoter region consists of 3 sub-sites(res site) and can process recombination. This cassette can resolve multimer that formed during replicative transposition, so it can also resolve plasmid multimer providing plasmid stability by avoiding dimer catastrophe. For this reason, it is multimer resolution system(MRS) that provide the same function as E.coli chromosome XerCD/dif but acts independent of cell cycle and may have higher efficiency on plasmids compared with slow XerCD system. false false _1075_ 0 13960 9 In stock false The native sequence have two PstI site, these sites have been cleared by mutagenesis. false Shan Chi Hsieh annotation2187447 1 resII-R range2187447 1 230 238 annotation2187452 1 recombination site range2187452 1 169 169 annotation2187444 1 resI-L range2187444 1 156 163 annotation2187449 1 resIII-R range2187449 1 260 268 annotation2187448 1 resIII-L range2187448 1 244 252 annotation2187446 1 resII-L range2187446 1 206 214 annotation2187435 1 tnpA range2187435 1 1 110 annotation2187437 1 tnpX range2187437 1 841 888 annotation2187436 1 tnpR range2187436 1 274 825 annotation2187451 1 PstI range2187451 1 612 612 annotation2187445 1 resI-R range2187445 1 176 184 annotation2187450 1 PstI range2187450 1 53 53 BBa_K817018_sequence 1 agatcccgttcatcaagatgaaaatagcgcgccagttgcacgtcattaggttatgcagcataacaaccgtaattctgtttttggtcagaggttagaaagtcgacaggcatatcaggctccctacctgacagttattcattaacaattttgcaaccgtccgaaatattataaattatcgcacacataaaaacagtgctgttaatgtgtctattaaatcgattttttgttataacagacactgcttgtccgatatttgatttaggatacatttttatgcgactttttggttacgcacgggtatcaaccagccagcaatctctcgatattcaggttcgggcactcaaagacgcaggcgtgaaagcaaatcgcatctttactgacaaggcatcgggcagttcaagcgatcggaaagggctggacttgctgaggatgaaggtggaggaaggtgacgtcatcttggtgaagaaacttgaccgccttgggcgcgatactgctgacatgatccagttaataaaagagtttgacgcccaaggtgtatccattcggtttattgatgacggaatcagtaccgatggggagatgggtaaaatggttgtcactattctatctgcggtggcccaggcagaacgacagagaatactagagcgtaccaatgaaggtcgccaagaggcaatggcaaaaggagttgtttttggtagaaaaagaaaaatagatagagatgcagtattaaatatgtggcaacaggggttaggtgcctcacatatatcaaaaacaatgaatattgctcgttcaacagtatataaagtaataaatgaaagcaactaacataaaaggttgaatatggaattgaatattacttcaaagtctaatccgtttggtgatacgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z