BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K817029 1 BBa_K817029 SP3-Penetratin-Flag 2012-09-22T11:00:00Z 2015-05-08T01:13:28Z SP3-Penetratin-Flag SP3-Penetratin-Flag false false _1075_ 0 13572 9 Not in stock false SP3-Penetratin-Flag false Jui-Tsen Yu annotation2201539 1 CPP range2201539 1 70 126 annotation2201540 1 FLAG range2201540 1 127 147 annotation2201478 1 SP3 range2201478 1 1 69 BBa_K817023 1 BBa_K817023 RBS-SP3-Penetratin-Flag 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z RBS-SP3-xx Released HQ 2013 RBS-SP3-xx false false _1075_ 0 13572 9 In stock true RBS-SP3-xx false Jui-Tsen Yu component2201547 1 BBa_K817029 component2201542 1 BBa_B0030 annotation2201542 1 BBa_B0030 range2201542 1 1 15 annotation2201547 1 BBa_K817029 range2201547 1 22 168 BBa_K817029_sequence 1 atgaaaaaaaacattgcgtttctgctggcgagcatgtttgtgtttagcattgcgaccaacgcgtatgcgcgccagattaaaatttggtttcagaaccgccgcatgaaatggaaaaaagattataaagatgatgatgataaataataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K817023_sequence 1 attaaagaggagaaatactagatgaaaaaaaacattgcgtttctgctggcgagcatgtttgtgtttagcattgcgaccaacgcgtatgcgcgccagattaaaatttggtttcagaaccgccgcatgaaatggaaaaaagattataaagatgatgatgataaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z