BBa_K817023 1 BBa_K817023 RBS-SP3-Penetratin-Flag 2012-09-17T11:00:00Z 2015-05-08T01:13:28Z RBS-SP3-xx Released HQ 2013 RBS-SP3-xx false false _1075_ 0 13572 9 In stock true RBS-SP3-xx false Jui-Tsen Yu component2201542 1 BBa_B0030 component2201547 1 BBa_K817029 annotation2201542 1 BBa_B0030 range2201542 1 1 15 annotation2201547 1 BBa_K817029 range2201547 1 22 168 BBa_K817036 1 BBa_K817036 J23119-RBS-SP3-Penetratin-Flag-xx 2012-09-23T11:00:00Z 2015-05-08T01:13:28Z J23119-RBS-SP3-Penetratin-Flag-xx J23119-RBS-SP3-Penetratin-Flag-xx false false _1075_ 0 13572 9 It's complicated false J23119-RBS-SP3-Penetratin-Flag-xx false Yen-Der Li component2201665 1 BBa_B0015 component2201658 1 BBa_K817023 component2201650 1 BBa_J23119 annotation2201650 1 BBa_J23119 range2201650 1 1 35 annotation2201658 1 BBa_K817023 range2201658 1 44 211 annotation2201665 1 BBa_B0015 range2201665 1 220 348 BBa_K817029 1 BBa_K817029 SP3-Penetratin-Flag 2012-09-22T11:00:00Z 2015-05-08T01:13:28Z SP3-Penetratin-Flag SP3-Penetratin-Flag false false _1075_ 0 13572 9 Not in stock false SP3-Penetratin-Flag false Jui-Tsen Yu annotation2201540 1 FLAG range2201540 1 127 147 annotation2201478 1 SP3 range2201478 1 1 69 annotation2201539 1 CPP range2201539 1 70 126 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K817029_sequence 1 atgaaaaaaaacattgcgtttctgctggcgagcatgtttgtgtttagcattgcgaccaacgcgtatgcgcgccagattaaaatttggtttcagaaccgccgcatgaaatggaaaaaagattataaagatgatgatgataaataataa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K817036_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagattaaagaggagaaatactagatgaaaaaaaacattgcgtttctgctggcgagcatgtttgtgtttagcattgcgaccaacgcgtatgcgcgccagattaaaatttggtttcagaaccgccgcatgaaatggaaaaaagattataaagatgatgatgataaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K817023_sequence 1 attaaagaggagaaatactagatgaaaaaaaacattgcgtttctgctggcgagcatgtttgtgtttagcattgcgaccaacgcgtatgcgcgccagattaaaatttggtttcagaaccgccgcatgaaatggaaaaaagattataaagatgatgatgataaataataa BBa_B0030_sequence 1 attaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z