BBa_K819002 1 BBa_K819002 Luminesensor repressible recA408 promoter 2012-09-01T11:00:00Z 2015-05-08T01:13:29Z This comes later. recA promoter in 408 form.recA promoter belongs to the SOS regulon family, and promotes in E.coli transcription of recA protein, which forms filament when bound to ssDNA and trigger the self-cleavage of LexA protein.recA408 have one SOS box, which binds to the dimerized LexA protein and cause inhibition of the transcription of downstream gene. false false _1077_ 0 13785 9 It's complicated false The original RecA was mutated to 408 form in order to be responsive to 408 mutant form of LexA DNA binding domain. false YU Zhou annotation2181609 1 RecA 408 promoter range2181609 1 1 81 annotation2181610 1 transcription start site range2181610 1 61 61 BBa_K819002_sequence 1 cttgtggcaacaatttctacaaaacacttgataccgtatgagcatacggtataattgcttcaacagaacatattgactatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z