BBa_K819003 1 BBa_K819003 Luminesensor repressible colE promoter 2012-09-01T11:00:00Z 2015-05-08T01:13:29Z the sequence of ColE promoter was found in a paper studying the ColE promoter family. colE promoter in its original form.colE promoter have two tandum SOS boxes, which put it under tighter control of LexA protein.When either of the SOS is bound by dimerized LexA protein, transcription of downstream gene will be inhibited. colE promotes the transcription of a gene which encodes colicin E, a bacteriocin produced by some strains of E.coli and released into the environment to reduce competition from other strains. true false _1077_ 0 13785 9 Discontinued false Original ColE promoter without any change. false LI Dayi annotation2181611 1 ColE promoter range2181611 1 1 152 BBa_K819003_sequence 1 tgtttttttgatcgttttcacaaaaatggaagtccacagtcttgacagggaaaatgcagcggcgtagcttttatgctgtatataaaaccagtggttatatgtacagtatttatttttaacttattgttttaaaagtcaaagaggattttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z