BBa_K819017 1 BBa_K819017 Luminesensor repressible SulA408 promoter 2012-09-15T11:00:00Z 2015-05-08T01:13:29Z SulA promoter sequence is got from regulon.org. Released HQ 2013 SulA promoter in 408 form.SulA promoter belongs to the SOS regulon family, and promotes in E.coli transcription of SulA protein. SulA408 promoter is reponsive to our optimized Luminesensor(BBa_K819005). false false _1077_ 0 13785 9 In stock false SulA promoter in 408 form. false YU Zhou annotation2197266 1 SulA408 Promoter range2197266 1 1 81 BBa_K819017_sequence 1 cgaggctctttccgaaaatagggttgatctttgttgtcactggatgtaccgtacatccatacggtaactcacaggggctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z