BBa_K822000 1 BBa_K822000 lldPRD operon promoter + RBS from E. coli 2012-09-22T11:00:00Z 2015-09-14T06:29:55Z E. coli K12 genome. Released HQ 2013 lldP is a promoter associated with the lldPRD operon of E. coli. The lldPRD operon encodes a lactate-dehydrogenase, and the lldP promoter has been shown to be induced by L-lactate. The activity of lldP may be repressed by chloramphenicol and nutrient-rich growth media. false false _1080_ 26442 11627 9 In stock true N/A. false Jarle Pahr annotation2200502 1 -35 range2200502 1 201 206 annotation2200507 1 transcriptional start site range2200507 1 235 235 annotation2200500 1 lldR binding site (O2) range2200500 1 256 272 annotation2200503 1 -10 range2200503 1 224 229 annotation2200508 1 RBS range2200508 1 333 338 annotation2200499 1 lldR binding site (O1) range2200499 1 130 146 BBa_K822000_sequence 1 cacattcctataggccgagtaaggtgttcacgccgcatccggcaagataaggcgctctggatcaacaacctaagggcaattctctgatgaggattgcccttttctttaccagacatctccccccacaagaattggccctaccaattcttcgcttatctgacctctggttcacaatttcccaattaaaactcacatcaatgttgccaatacataacatttagttaaccattcattgtcattatccctacacaacacaattggcagtgccacttttacacaacgtgtgacaaggagatgagcaacagactcattacacgatgtgcgtggactccaggagacctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z