BBa_K823000 1 BBa_K823000 P<sub>liaG</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 Promoter of the liaG gene of Bacillus subtilis, weak constitutive false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2182553 1 PliaG range2182553 1 1 121 annotation2182555 1 -10 box range2182555 1 105 110 annotation2182554 1 -35 box range2182554 1 81 86 BBa_K823000_sequence 1 caaaaatcagaccagacaaaagcggcaaatgaataagcggaacggggaaggatttgcggtcaagtccttcccttccgcacgtatcaattcgcaagcttttcctttataatagaatgaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z