BBa_K823001 1 BBa_K823001 P<sub><i>liaI</i></sub> promoter of <i>Bacillus subtilis</i> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 PliaI is the promoter of the PliaI gene of Bacillus subtilis, which is inducible by bacitracin. It does not contain a ribosome binding site. false false _1081_ 0 12081 9 In stock true no considerations false Korinna Kraft annotation2202715 1 PliaI range2202715 1 1 209 annotation2202718 1 +1 range2202718 1 197 197 annotation2202721 1 -35 range2202721 1 160 165 annotation2202717 1 liaR-binding range2202717 1 125 159 annotation2202720 1 -10 range2202720 1 185 190 BBa_K823001_sequence 1 attggccaaagcagaaaggtccgacctaattaaagaaagggaagcaagtgttcatctgtaaagggttttaaaacgccatgcctcgtgcatggcgtttttttgtgccaatgggtccggtgcgagatacgactccggtcttatataaaaatcaatctctgattcgttttgcatatcttccaacttgtataagatgaagacaaggaaaacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z