BBa_K823002 1 BBa_K823002 P<sub>lepA</sub> 2012-07-15T11:00:00Z 2015-05-08T01:13:29Z Bacillus subtilis Released HQ 2013 PlepA is the promoter of the PlepA gene of Bacillus subtilis. It is a constitutive promoter and does not contain a ribosome binding site. false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft BBa_K823002_sequence 1 agtcaatgtatgaatggatacgggatatgaatcaataagtacgtgaaagagaaaagcaacccagatatgatagggaacttttctctttcttgttttacattgaatctttacaatcctattgatataatctaagctagtgtattttgcgtttaatagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z