BBa_K823004 1 BBa_K823004 Anderson promoter J23100 2012-09-07T11:00:00Z 2015-07-07T11:43:33Z Partsregistry Released HQ 2013 Anderson promoter J23100 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182508 1 -10 box range2182508 1 24 29 annotation2182507 1 -35 box range2182507 1 1 6 annotation2182506 1 J23100 range2182506 1 1 35 BBa_K823004_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z