BBa_K823005 1 BBa_K823005 Anderson promoter J23101 2012-09-07T11:00:00Z 2015-07-07T11:44:25Z Partsregistry Released HQ 2013 Anderson promoter J23101 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182510 1 -35 box range2182510 1 1 6 annotation2182509 1 J23101 range2182509 1 1 35 annotation2182511 1 -10 box range2182511 1 24 29 BBa_K823005_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z