BBa_K823007 1 BBa_K823007 Anderson promoter J23103 2012-09-07T11:00:00Z 2015-07-07T11:46:24Z Partsregistry Released HQ 2013 Anderson promoter J23103 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182516 1 -35 box range2182516 1 1 6 annotation2182515 1 J23103 range2182515 1 1 35 annotation2182517 1 -10 box range2182517 1 24 29 BBa_K823007_sequence 1 ctgatagctagctcagtcctagggattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z