BBa_K823009 1 BBa_K823009 Anderson promoter J23107 2012-09-07T11:00:00Z 2015-05-08T01:13:30Z Partsregistry Released HQ 2013 Anderson promoter J23107 (with one nucleotide different to the original Anderson promoter sequence) without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 0 12081 9 In stock false no considerations false Korinna Kraft annotation2182531 1 J23107 range2182531 1 1 35 annotation2182532 1 -35 box range2182532 1 1 6 annotation2182533 1 -10 box range2182533 1 24 29 BBa_K823009_sequence 1 tttacggctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z