BBa_K823011 1 BBa_K823011 Anderson promoter J23114 2012-09-07T11:00:00Z 2015-07-07T11:50:55Z Partsregistry Released HQ 2013 Anderson promoter J23114 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182539 1 -10 box range2182539 1 24 29 annotation2182538 1 -35 box range2182538 1 1 6 annotation2182537 1 J23114 range2182537 1 1 35 BBa_K823011_sequence 1 tttatggctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z