BBa_K823013 1 BBa_K823013 Anderson promoter J23117 2012-09-07T11:00:00Z 2015-07-07T11:51:22Z Partsregistry Released HQ 2013 Anderson promoter J23117 without RFP in backbone vector pSB1C3 to easily fuse the promoter with other reporters e.g. the lux operon. false false _1081_ 4206 12081 9 In stock false no considerations false Korinna Kraft annotation2182545 1 -10 box range2182545 1 24 29 annotation2182544 1 -35 box range2182544 1 1 6 annotation2182543 1 J23117 range2182543 1 1 35 BBa_K823013_sequence 1 ttgacagctagctcagtcctagggattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z