BBa_K823030 1 PcotYZ P_<i>cotYZ</i>: <i>B. subtilis</i> promoter regulating expression of spore crust proteins 2012-09-05T11:00:00Z 2015-05-08T01:13:30Z B. subtilis W168 genome PcotYZ: B. subtilis promoter regulates spore crust proteins and is activated in late sporulation. PcotYZ regulates the crust protein cotZ and cotY. false false _1081_ 0 12084 9 It's complicated false We use this promoter for the expression of fusion proteins on B. subtilis spores. false Franziska D??rr annotation2200628 1 -10 range2200628 1 150 157 annotation2182004 1 PcotYZ range2182004 1 1 183 BBa_K823030_sequence 1 gacagcaacaaatacactcgtagccatcctagttatcactcttgtcctctaggacctaaaagcagagctaaaaacgctctgctttttcttattttccaagcatatgatgaatatatagacgttcacccacaccaagtggggcacgggtacatatgttgttaaggactaaagtcaaataccctataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z