BBa_K823035 1 BBa_K823035 HA-tag (Freiburg standard+RBS) 2012-09-06T11:00:00Z 2015-05-08T01:13:30Z gene synthesis by gene art. HA-tag with RBS in Freiburg standard. prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT false false _1081_ 0 6378 9 In stock false For N- and C-terminal in-frame translational fusion to other genes in Freiburg standard. false Jara Radeck BBa_K823035_sequence 1 tatccgtatgatgttccggattatgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z