BBa_K823038 1 BBa_K823038 Strep-tag (Freiburg standard+RBS) 2012-09-07T11:00:00Z 2015-05-08T01:13:30Z Gene synthesis by GeneArt Streptavidin - tag with RBS in [[Help:Assembly_standard_25|Freiburg standard]]. prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions: [[Part:BBa_K823034|3x FLAG - tag]] [[Part:BBa_K823035|HA - tag]] [[Part:BBa_K823036|cMyc - tag]] [[Part:BBa_K823037|His - tag]] [[Part:BBa_K823038|Streptavidin - tag]] Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox]. false false _1081_ 0 11555 9 In stock false We designed the part in Freiburg standard for N- and C-terminal fusions false Jara Radeck annotation2182334 1 Strep range2182334 1 1 24 BBa_K823038_sequence 1 tggagccacccgcagttcgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z