BBa_K823029 1 BBa_K823029 mKate2, a red monomeric fluorescent protein, B. subtilis optimized 2012-08-29T11:00:00Z 2015-05-08T01:13:30Z Synthesised by gene art. Codon optimized for Bacillus subtilis. mKate2 is a red fluorescent protein that is monomeric. It is in Freiburg standard and has a RBS included with the correct spacing. More to come. false false _1081_ 0 6378 9 In stock false see above false Jara Radeck BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K823051 1 BBa_K823051 mKate2, a red monomeric fluorescent protein + RBS + Term 2012-09-09T11:00:00Z 2015-05-08T01:13:30Z mkate: synthesized gy gene art terminator: registry red monomeric fluorscent protein in Freiburg standard (RCF 25), with RBS and Terminator (B0014). false false _1081_ 0 6378 9 It's complicated false Only needs 1 3A-assembly with desired promoter. false Jara Radeck component2182421 1 BBa_K823029 component2182428 1 BBa_B0014 annotation2182421 1 BBa_K823029 range2182421 1 1 702 annotation2182428 1 BBa_B0014 range2182428 1 711 805 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K823029_sequence 1 atggccggcgtttctgaacttatcaaagaaaacatgcatatgaaactttacatggaaggcacagttaacaaccatcatttcaaatgcacatctgaaggcgaaggcaaaccttacgaaggcacacaaacaatgcgtatcaaagctgttgaaggcggcccacttccattcgctttcgatatacttgctacatctttcatgtacggctctaaaacattcatcaaccatacacaaggcatacctgacttcttcaaacaatcgttccctgaaggcttcacatgggaacgtgttacaacatacgaagatggcggcgttcttacagctacacaagatacatctcttcaagatggctgccttatctacaacgttaaaatccgtggcgttaacttcccttctaacggccctgttatgcaaaaaaaaacacttggctgggaagcttctacagaaacactttaccctgctgatggcggccttgaaggccgtgctgatatggctcttaaacttgttggcggcggccatcttatctgcaaccttaaaacaacataccgttctaaaaaacctgctaaaaaccttaaaatgcctggcgtttactacgttgatcgtcgtcttgaacgtatcaaagaagctgataaagaaacatacgttgaacaacatgaagttgctgttgctcgttactgcgatcttccttctaaacttggccatcgt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K823051_sequence 1 atggccggcgtttctgaacttatcaaagaaaacatgcatatgaaactttacatggaaggcacagttaacaaccatcatttcaaatgcacatctgaaggcgaaggcaaaccttacgaaggcacacaaacaatgcgtatcaaagctgttgaaggcggcccacttccattcgctttcgatatacttgctacatctttcatgtacggctctaaaacattcatcaaccatacacaaggcatacctgacttcttcaaacaatcgttccctgaaggcttcacatgggaacgtgttacaacatacgaagatggcggcgttcttacagctacacaagatacatctcttcaagatggctgccttatctacaacgttaaaatccgtggcgttaacttcccttctaacggccctgttatgcaaaaaaaaacacttggctgggaagcttctacagaaacactttaccctgctgatggcggccttgaaggccgtgctgatatggctcttaaacttgttggcggcggccatcttatctgcaaccttaaaacaacataccgttctaaaaaacctgctaaaaaccttaaaatgcctggcgtttactacgttgatcgtcgtcttgaacgtatcaaagaagctgataaagaaacatacgttgaacaacatgaagttgctgttgctcgttactgcgatcttccttctaaacttggccatcgttactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z