BBa_K174017 1 BBa_K174017 CadA promoter with CzrA binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:17Z It is taken from ''B. subtilis'' ''cadA'' promoter. In ''B. subtilis'' CadA system works as an efflux system to take the metals out in the cell. It is normally repressed by CzrA repressor protein. When certain metals get inside the cell, they can bind to CzrA and derepress the promoter expressing CadA. Hence metals are taken out by the efflux system. By taking the promoter of CadA system, we created a generic metal sensor. Hence when it is combined with coding sequences of other genes, it will regulate the expression of these genes upon sensing metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing false The Newcastle 2009 iGEM team annotation2040827 1 cadA promoter range2040827 1 11 144 annotation2040828 1 sigA -35 range2040828 1 18 23 annotation2040830 1 CzrA binding site range2040830 1 56 86 annotation2040829 1 sigA -10 range2040829 1 42 47 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_I13401 1 BBa_I13401 GFP reporter for RHS of library test constructs 2005-04-05T11:00:00Z 2015-08-31T04:07:33Z Released HQ 2013 This part will be suffixed to a promoter.RBS library. The purpose of the experiment is to make a first pass at a library-based construction step to identify efficiency issues and also to examine maxPOPS/RIPS level. false true _6_ 0 2 6 In stock false This part was built by Jen as an intermediate to their nuts and bolts parts. true jasonk component1476718 1 BBa_B0010 component1476713 1 BBa_E0040 component1476728 1 BBa_B0012 annotation1476718 1 BBa_B0010 range1476718 1 729 808 annotation1476713 1 BBa_E0040 range1476713 1 1 720 annotation1476728 1 BBa_B0012 range1476728 1 817 857 BBa_K174016 1 BBa_K174016 Promoterless ArsR binding site 2009-10-13T11:00:00Z 2015-07-24T01:17:49Z ''B. subtilis'' This part purely holds the binding site for ArsR protein which can be released when bound to different metals. Hence this part can be combined with any promoter to sense metals that can bind to ArsR protein. When added in front of a promoter with another metal sensor's protein's binding site, it can form an AND gate to sensitively detect specific metals. false false _277_ 4206 3942 9 Not in stock false It was developed mainly to use combinatorial approaches for metal sensing. false The Newcastle 2009 iGEM team annotation2040774 1 ArsR binding site range2040774 1 9 26 BBa_K824008 1 BBa_K824008 Cadmium Promoter with GFP Reporter 2012-09-30T11:00:00Z 2015-07-24T01:19:31Z This part is a combination of 2007 Brown's iGEM part BBa_K174015 and MIT's part (from 2005) I13401. We digested the promoter responsive to Cadmium (BBa_K174015) with EcoRI and SpeI and digested the GFP plasmid (BBa_I13401) with XbaI and PstI. The promoter was Chloramphenicol resistant and the GFP was Ampicillin resistant. These digested fragments were mixed and ligated to the provided, linearized pSB3C1 plasmid. The ligation mix was grown under Chloramphenicol selection. The resulting colonies were tested for responsive GFP production from the addition of Cadmium and Arsenic, respectively. false false _786_1082_ 4206 9218 9 It's complicated true none false Steven Allen component2205254 1 BBa_K174015 component2205262 1 BBa_I13401 annotation2205262 1 BBa_I13401 range2205262 1 212 1068 annotation2205254 1 BBa_K174015 range2205254 1 1 205 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K174015 1 BBa_K174015 Cadmium Sensor 2009-10-13T11:00:00Z 2015-05-08T01:10:58Z CadA promoter which has the binding site for CzrA protein is combined with ArsR binding site to create this AND gate Cadmium sensor. This Cadmium sensor has binding sites for ArsR and CzrA metal sensors. By placing them together, our device works as an AND gate and senses Cadmium when both proteins bind to Cadmium. When Cadmium is not present both proteins bind to their relevant sites on the promoter and represses the expression of downstream genes. When Cadmium present in the environment, it binds to these repressors which then fall of from where they are bound to on the promoter. Hence the promoter becomes free to express the downstream genes as an indication of Cadmium. This combinatorial approach enables us to filter out sensing other metals. ArsR and CzrA can bind to different metals, however when both are used as an ANd gate, they will only recognize Cadmium. false false _277_ 0 3942 9 It's complicated true We wanted to sense Cadmium accurately and used a combinatorial approach to achieve our goal. false The Newcastle 2009 iGEM team component2040851 1 BBa_K174016 component2040856 1 BBa_K174017 annotation2040856 1 BBa_K174017 range2040856 1 35 205 annotation2040851 1 BBa_K174016 range2040851 1 1 26 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K824008_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagctactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K174017_sequence 1 gcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_K174015_sequence 1 agtaatcaaaataaattgatttattttactagaggcgcttgctgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaagctaagaggaggaactactatggctagc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_I13401_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K174016_sequence 1 agtaatcaaaataaattgatttattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z