BBa_K827008 1 BBa_K827008 artificial designed terminator 2012-09-23T11:00:00Z 2015-05-08T01:13:31Z This sequence is synthesized artificially. This part is designed to test the property of terminators. false false _1085_ 0 12222 9 Not in stock false NO. false Liuxing Shen BBa_K827008_sequence 1 gagcaatcagatacccagccgcctaatgagcggcttttttttgaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z