BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_K1109005 1 BBa_K1109005 Anti-legionella unit 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Oligonucleotide sequence of the anti-legionella peptide was obtained from genomic sequence, and sequence of the PelB leader peptide was obtained from iGEM database. Some Staphylococcus strains produce anti-Legionella peptide. ORF for anti-legionella peptide specifically encodes for a 22 amino acid peptide. Anti-legionella unit is a biobrick for suitable suffix and prefix regions. It contains a PelB leader sequence in the upstream of the anti-legionella peptide ORF to direct the peptide outside the cell. false false _1420_ 0 11226 9 It's complicated false Anti-legionella unit is a biobrick for suitable suffix and prefix regions. It was derived from synthetic oligonucleotides by tandem hybridization reactions, and amplified by PCR. false Dr. ??zlem Darcansoy &#304;&#351;eri BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K1109001 1 BBa_K1109001 LqsR promoter 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Legionella pneumophila genomic lqs gene cluster was cloned into pNT-1 plasmid(Cellular Microbiology 9(12):2903-2920, 2007.) LqsR promoter region was amplified by PCR as a biobrick. LqsR is the gene encoding response regulator component of the legionella quorum sensing (lqs). LqsR promoter region is controlled by its own response regulator LqsR. false false _1420_ 0 11226 9 Not in stock false This part is a new biobrick with prefix and suffix regeions. false Dr. ??zlem Darcansoy &#304;&#351;eri BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1109003 1 BBa_K1109003 LqsR promoter with RBS 2013-09-22T11:00:00Z 2015-05-08T01:09:10Z Legionella pneumophila genomic lqs gene cluster was cloned into pNT-1 plasmid (Cellular Microbiology 9(12):2903-2920, 2007.) LqsR promoter region was amplified by PCR as a biobrick, and ligated with RBS (BBa_B0034). LqsR is the gene encoding response regulator component of the legionella quorum sensing (lqs). LqsR promoter region is controlled by its own response regulator LqsR. This composite part contains RBS downstream of the promoter region. When any ORF is cloned to the downstream of this composite part, it can be expressed in response to legionella auto-inducer (LAI-I). false false _1420_ 0 11226 9 It's complicated false LqsR promoter part is a new biobrick with prefix and suffix regions, and RBS (BBa_B0034) was ligated to downstream of it. false Dr. ??zlem Darcansoy &#304;&#351;eri component2358476 1 BBa_B0034 component2358474 1 BBa_K1109001 annotation2358474 1 BBa_K1109001 range2358474 1 1 266 annotation2358476 1 BBa_B0034 range2358476 1 275 286 BBa_K830000 1 BBa_K830000 anti legionella cassette 2013-10-01T11:00:00Z 2015-05-08T01:13:32Z Anti-legionella unit synthesized. Other part of this composite is LqsR promoter. And LqsR promoter region was amplified by PCR as a biobrick, and ligated with RBS (BBa_B0034). anti-legionella (Warnericin RK) peptide, which is directed to periplasmic space by pelB leader sequence, and some proteins are transcribed with lqsR promoter.lqsR promoter is activated by phosphorylated lqsR. This provides synthesis of anti-legionella (Warnericin RK) peptide and marker protein in case of lqsA presence in environment. false false _1420_ 0 11224 9 Not in stock false None false Berkhan GEN?? component2367102 1 BBa_B0014 component2367094 1 BBa_K1109003 component2367095 1 BBa_K1109005 annotation2367094 1 BBa_K1109003 range2367094 1 1 286 annotation2367102 1 BBa_B0014 range2367102 1 436 530 annotation2367095 1 BBa_K1109005 range2367095 1 293 427 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0034_sequence 1 aaagaggagaaa BBa_K830000_sequence 1 gagcaaaacgttccaaagttatatcctttctatgaacttcaaataacctgtggctccatcatcagaacctggctaacttgtgaataaagtaacatgattgtttattataaccaaattatttaggttttatattcaccgggctttttggagtaagtattcaaaataagcgctcttaaaatcaaagctcaaaattagacaagttattgaatataagtctatattattaaataagtaccttatcttagctaagaaatcaaaaaaggatatactagagaaagaggagaaatactagatgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatgcaatttatcacagatcttatcaaaaaagcagtagatttcttcaaaggtttatttggtaacaaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K1109001_sequence 1 gagcaaaacgttccaaagttatatcctttctatgaacttcaaataacctgtggctccatcatcagaacctggctaacttgtgaataaagtaacatgattgtttattataaccaaattatttaggttttatattcaccgggctttttggagtaagtattcaaaataagcgctcttaaaatcaaagctcaaaattagacaagttattgaatataagtctatattattaaataagtaccttatcttagctaagaaatcaaaaaaggata BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K1109005_sequence 1 atgaaatacctgctgccgaccgctgctgctggtctgctgctcctcgctgcccagccggcgatggccatgcaatttatcacagatcttatcaaaaaagcagtagatttcttcaaaggtttatttggtaacaaataa BBa_K1109003_sequence 1 gagcaaaacgttccaaagttatatcctttctatgaacttcaaataacctgtggctccatcatcagaacctggctaacttgtgaataaagtaacatgattgtttattataaccaaattatttaggttttatattcaccgggctttttggagtaagtattcaaaataagcgctcttaaaatcaaagctcaaaattagacaagttattgaatataagtctatattattaaataagtaccttatcttagctaagaaatcaaaaaaggatatactagagaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z