BBa_K831003 1 BBa_K831003 TisB toxin of Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR TisB is the toxin of the TisAB chromosomal toxin-antitoxin (TA) module. TisB is a small membrane active antimicrobial peptide is induced during the S.O.S stress response. Also, its induction has been shown to induce persistence (D??rr, et al, 2010) false false _1090_ 0 9809 9 It's complicated true Due to the toxicity of TisB, the construction of composite parts for its induction must be done using inducible promoters with low leakage. false Silvia J Ca??as annotation2199210 1 TisB range2199210 1 1 90 BBa_K831003_sequence 1 atgaacctggtggatatcgccattcttatcctcaaactcattgttgcagcactgcaactgcttgatgctgttctgaaatacctgaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z