BBa_K831004 1 BBa_K831004 istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12 that acts as antitoxin for TisB toxin. TisB is a small membrane active antimicrobial peptide induced during the S.O.S stress response. Also, its induction has been shown to induce persistence (D??rr, et al, 2010) false true _1090_ 0 9809 9 It's complicated true None false Silvia J Ca??as annotation2199260 1 istR range2199260 1 1 140 BBa_K831004_sequence 1 gcactaaatacgtcaaaattcgtgccgaaattgcgcgttctgcgcggaacacgtatactttcagtgttgacataatacagtgtgctttgcggttaccagccgcaggcgactgacgaaacctcgctccggcggggtttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z