BBa_K831005 1 BBa_K831005 MqsR toxin of Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR MqsR (Motility quorum sensing regulator) is the toxin of the MqsRA chromosomal toxin-antitoxin (TA) module. MqsR is associated with biofilm formation and development and is linked to persisters generation frequencies (Kim Y et al, 2010) false false _1090_ 0 9809 9 Not in stock false None false Silvia J Ca??as annotation2199393 1 MqsR range2199393 1 1 297 BBa_K831005_sequence 1 atggaaaaacgcacaccacatacacgtttgagtcaggttaaaaaacttgtcaatgccgggcaagttcgtacaacacgtagtgccctgttaaatgcagatgagttaggtttggattttgatggtatgtgtaatgttatcattggattatcagagagcgacttttataaaagcatgaccacctactctgatcatactatctggcaggatgtttacagacccaggcttgttacaggccaggtttatcttaaaattacggtaattcatgacgtactgatcgtctcgtttaaggagaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z