BBa_K831006 1 BBa_K831006 Inducible MqsR toxin under the control of tetR promoter 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR Released HQ 2013 MqsR (Motility quorum sensing regulator) is the toxin of the MqsRA chromosomal toxin-antitoxin (TA) module. MqsR is associated with biofilm formation and development and is linked to persisters generation frequencies (Kim Y et al, 2010) true false _1090_ 0 9809 9 Discontinued false No false Silvia J Ca??as annotation2199400 1 -10 range2199400 1 43 48 annotation2199397 1 TetR 1 range2199397 1 1 19 annotation2199399 1 TetR 2 range2199399 1 26 44 annotation2199396 1 BBa_R0040 range2199396 1 1 54 annotation2199398 1 -35 range2199398 1 20 25 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K831006_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z