BBa_K831005 1 BBa_K831005 MqsR toxin of Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR MqsR (Motility quorum sensing regulator) is the toxin of the MqsRA chromosomal toxin-antitoxin (TA) module. MqsR is associated with biofilm formation and development and is linked to persisters generation frequencies (Kim Y et al, 2010) false false _1090_ 0 9809 9 Not in stock false None false Silvia J Ca??as annotation2199393 1 MqsR range2199393 1 1 297 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 BBa_K831007 1 BBa_K831007 Inducible MqsR toxin under the control of tetR promoter 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR MqsR (Motility quorum sensing regulator) is the toxin of the MqsRA chromosomal toxin-antitoxin (TA) module. MqsR is associated with biofilm formation and development and is linked to persisters generation frequencies (Kim Y et al, 2010) false false _1090_ 0 9809 9 It's complicated true No false Silvia J Ca??as component2199401 1 BBa_R0040 component2199407 1 BBa_K831005 annotation2199407 1 BBa_K831005 range2199407 1 61 357 annotation2199401 1 BBa_R0040 range2199401 1 1 54 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K831005_sequence 1 atggaaaaacgcacaccacatacacgtttgagtcaggttaaaaaacttgtcaatgccgggcaagttcgtacaacacgtagtgccctgttaaatgcagatgagttaggtttggattttgatggtatgtgtaatgttatcattggattatcagagagcgacttttataaaagcatgaccacctactctgatcatactatctggcaggatgtttacagacccaggcttgttacaggccaggtttatcttaaaattacggtaattcatgacgtactgatcgtctcgtttaaggagaagtaa BBa_K831007_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagatggaaaaacgcacaccacatacacgtttgagtcaggttaaaaaacttgtcaatgccgggcaagttcgtacaacacgtagtgccctgttaaatgcagatgagttaggtttggattttgatggtatgtgtaatgttatcattggattatcagagagcgacttttataaaagcatgaccacctactctgatcatactatctggcaggatgtttacagacccaggcttgttacaggccaggtttatcttaaaattacggtaattcatgacgtactgatcgtctcgtttaaggagaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z